View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5077-Insertion-8 (Length: 288)
Name: NF5077-Insertion-8
Description: NF5077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5077-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 8 - 143
Target Start/End: Original strand, 32533873 - 32534010
Alignment:
| Q |
8 |
agaagatgatgtgttcttggtagggttttgccagctttgttggtttttagaggggtttgatgtgagtaccgagtagtgg--aatatgtgtttgaattttg |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32533873 |
agaagatgatgtgttgttggtagggttttgccagctttgttggtttttagaggggtttgatgtgagtaccgagtagtggacaatatgtgtttgaattttg |
32533972 |
T |
|
| Q |
106 |
ttatgtagccattcatgattgtggtttgtagagtcgaa |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32533973 |
ttatgtagtcattcatgattgtggtttgtagagtcgaa |
32534010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 196 - 284
Target Start/End: Original strand, 32534063 - 32534151
Alignment:
| Q |
196 |
agccttcgatggagttgtgtctttattgatatctacgatgtacgacgtatgaattttcttttggatgtttcacctaaatacggtgttat |
284 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||||||||||||| |||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
32534063 |
agccttcggtggagtcgtgtctttattgatgtctacgatgtacggcgtatgaattttttttttggtgtttcacctaaatacggtgttat |
32534151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University