View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5078_low_3 (Length: 365)
Name: NF5078_low_3
Description: NF5078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5078_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 353
Target Start/End: Original strand, 3568644 - 3568979
Alignment:
| Q |
18 |
aatacgcccttctggctcctcacccacattggcgcatcagcagaatgatcttgctaactcggccaacatagcacatttagattatgagggcgtgcacagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3568644 |
aatacgcccttctggctcctcacccacattggcgcatcagcagaatgatcttgctaactcggccaacatagcacatttggattatgagggcgtgcacagt |
3568743 |
T |
|
| Q |
118 |
gaggagcaacagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568744 |
gaggagcaacagctggttgcacgtgaggatgctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaa |
3568843 |
T |
|
| Q |
218 |
ggatatacatcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctgatttt |
317 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3568844 |
ggatatatatcctaacatccaacatgacatggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctggtttt |
3568943 |
T |
|
| Q |
318 |
ttggcagatgatatagttcattatagtaacacaggt |
353 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3568944 |
ttggcagatgatatagttcataatagtaacacaggt |
3568979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 273 - 357
Target Start/End: Original strand, 18485273 - 18485357
Alignment:
| Q |
273 |
gtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggttctg |
357 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |||||| | || |||||| |||||||| |
|
|
| T |
18485273 |
gtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University