View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5079-Insertion-10 (Length: 168)
Name: NF5079-Insertion-10
Description: NF5079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5079-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 8 - 168
Target Start/End: Original strand, 35330470 - 35330630
Alignment:
| Q |
8 |
tggaggactgacatgttcatgaagatattccaaacccttggcagcttcaagtgctattcttaatcgagtttcccaatctagattaacagacatgacactg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35330470 |
tggaggactgacatgttcatgaagatattccaaacccttggcagcttcaagtgctattcttaatcgagtttcccaatctagattaacagacatgacactg |
35330569 |
T |
|
| Q |
108 |
gaatctacaagaaaacaattcatcaaaatcaactccaacattacaaataacaaaatattgg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35330570 |
gaatctacaagaaaacaattcatcaaaatcaactccaacattacaaataacaaaatattgg |
35330630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University