View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5080-Insertion-5 (Length: 283)
Name: NF5080-Insertion-5
Description: NF5080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5080-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 8 - 164
Target Start/End: Complemental strand, 53052923 - 53052767
Alignment:
| Q |
8 |
atattttattttcacaaaactactactcccacggccactcctccctctcatccctctactactttagagacgagaaatggcattttcacacttaaatttg |
107 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53052923 |
atattgtattttcacaaaagtactactcccacggccactcctccctctcatccctctactagtttagagacgagaaatggcattttcatacttaaatttg |
53052824 |
T |
|
| Q |
108 |
atatcaaaatttcacaacaattttaaatggttaatgcagtttaactatgtttttaag |
164 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53052823 |
atatcaaaatttaacaacaattttaaatggttaatgcagtttaaatatgtttttaag |
53052767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 198 - 281
Target Start/End: Complemental strand, 53052760 - 53052677
Alignment:
| Q |
198 |
tagatgggtccaatatgtttacacataacaaaatagtaaagagagagtgtagggttcatagtccccattcgcttcaaacacctc |
281 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
53052760 |
tagatgggttcaatatgtatacacataacaaaatagtaaagagagagtgtagggttcataatccccgttcgctacaaacacctc |
53052677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University