View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5080-Insertion-6 (Length: 48)
Name: NF5080-Insertion-6
Description: NF5080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5080-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.0000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.0000000000008
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 26302699 - 26302659
Alignment:
| Q |
8 |
cctctacactaattctattccaaaactcgttcacttttgat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26302699 |
cctctacactaattctattccaaaactcgttctcttttgat |
26302659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University