View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_high_20 (Length: 253)
Name: NF5081_high_20
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_high_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 9234517 - 9234761
Alignment:
| Q |
18 |
atttggagggtttgatgcaagacatatcctattttcctcctctcgatttccaagtttaattgtcttttcattcttttgaatttccaatcaccccttgtcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| |||||||||||||||||||||| || |
|
|
| T |
9234517 |
atttggagggtttgatgcaagacatatcctattttcctcctcttgatttccaagtttaatggccttttcattcctttgaatttccaatcaccccttctcg |
9234616 |
T |
|
| Q |
118 |
catttgatctctctctaaattggatactctacagccaaccttatggtgcagccggctatagacaactatatttgaatagagaaaatttctctttctgaat |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
9234617 |
cctttgatctctctctaaattggatactctacaaccaaccttatggtgcaaccggctatagacaactatatctgaatagagaaaatttctctgtctgaat |
9234716 |
T |
|
| Q |
218 |
ttaacggt---------tgcattgtaaagctgaacgtagaggatt |
253 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
9234717 |
ttaacggtacaaccggatgcattgtaaagctgaatgtagaggatt |
9234761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University