View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_high_25 (Length: 248)
Name: NF5081_high_25
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 37655537 - 37655314
Alignment:
| Q |
19 |
tgtatgacattgatggcgatggtttcatcacagcgaaggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37655537 |
tgtatgacattgatggcgatggtttcatcacggcgaaggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaat |
37655438 |
T |
|
| Q |
119 |
tattggtcgcgttgatagtgatggtgatggtaggattgattttgaggattttagaatcatgatgatgatgggttctcgccataatagagtcgaacatcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37655437 |
tattggtcgcgttgatagtgatggtgatggtaggattgattttgaggattttagaatcatgatgatgatgggttctcgccataatagagtcgaacatcaa |
37655338 |
T |
|
| Q |
219 |
acttgacatttctttctttgtatt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37655337 |
acttgacatttctttctttgtatt |
37655314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 185
Target Start/End: Complemental strand, 37653644 - 37653536
Alignment:
| Q |
77 |
aagcattggtcaagagtgttccttggatgaatgtgaaagaattattggtcgcgttgatagtgatggtgatggtaggattgattttgaggattttagaatc |
176 |
Q |
| |
|
|||| ||||| ||||||| ||||||| |||||| |||||| || || ||||||| | ||||||||||| || |||||||| || || ||||||||| |
|
|
| T |
37653644 |
aagctttggtgaagagtgctccttggccaaatgtggaagaatgataggctgcgttgacaccgatggtgatggcagaattgatttcgatgaatttagaatc |
37653545 |
T |
|
| Q |
177 |
atgatgatg |
185 |
Q |
| |
|
||||||||| |
|
|
| T |
37653544 |
atgatgatg |
37653536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 196
Target Start/End: Complemental strand, 44377798 - 44377731
Alignment:
| Q |
129 |
gttgatagtgatggtgatggtaggattgattttgaggattttagaatcatgatgatgatgggttctcg |
196 |
Q |
| |
|
|||||||| || |||||||| | ||||||||||| || ||||| || |||||||||||||||||||| |
|
|
| T |
44377798 |
gttgatagcgacggtgatggaacaattgattttgaagagtttaggatgatgatgatgatgggttctcg |
44377731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University