View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_high_28 (Length: 233)
Name: NF5081_high_28
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 4871963 - 4872178
Alignment:
| Q |
1 |
tgcctccgcttcctcgtcctccttgttactataaatgggtgaaggaaacaatagcttatatcaattctgctactcgtgatttcgatgacatgctctctcg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4871963 |
tgcctcctcttcctcgtcctccttgttactataaatgggtgaaggaaacaatagcttatatcaattctgctactcgtgatttcgatgacatgctctctcg |
4872062 |
T |
 |
| Q |
101 |
cggttactctaccatatccgattatatcgctcttttttcttcccttcttaatatccatcaacacagcactgttcttagacttgctaaacaatttgaatcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872063 |
cggttactctaccatatccgattataacgctcttttttcttcccttcttaatatccatcaacacagcactgttcttagacttgctaaacaatttgaatcg |
4872162 |
T |
 |
| Q |
201 |
caaaaccctaaccttc |
216 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
4872163 |
caagaccctaaccttc |
4872178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University