View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_16 (Length: 310)
Name: NF5081_low_16
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 38840896 - 38841114
Alignment:
| Q |
5 |
aaaatagaatcaaacagatgtcggcggtgattctacattgtatgcatcaaaattgattcaccgattgagcatataccaaaatattatcaaatatacaaaa |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
38840896 |
aaaataaaatcaaacagatgtcggcggtgattctacattgtatgcatcaaaattgagtcaccgattgagtatataacaaaatattatcaaatatacaaaa |
38840995 |
T |
|
| Q |
105 |
atttcaattcattacaccaaacatgaaaaaccatagcagaatcatatatcaacagactcaatatcagttcattacaccaaaaattataaaccctggcaaa |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38840996 |
acttcaattcattacaccaaacatgaaaaaccatagcagaatcatatatcaacagactcaatatcagttcattacaccaaaaattataaaccctagcaaa |
38841095 |
T |
|
| Q |
205 |
atcataaatcaagaaatta |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38841096 |
atcataaatcaagaaatta |
38841114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 93
Target Start/End: Original strand, 9876281 - 9876342
Alignment:
| Q |
33 |
gattctacattgtatgcatcaaaattgattcaccg-attgagcatataccaaaatattatca |
93 |
Q |
| |
|
|||||||||||||||||| ||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
9876281 |
gattctacattgtatgcactaaaatggaggcaccttattgagcatataccaaaatattatca |
9876342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University