View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_19 (Length: 264)
Name: NF5081_low_19
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_19 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 49976 - 49735
Alignment:
| Q |
13 |
aatatcacatgaaactttgataatttgattatta------catgaaatcatgattcaaatacttggatgtacacgtttggttttgtgaattgtgattatt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976 |
aatatcacaggaaactttgataatttgattattattattacatgaaatcatgattcaaatacttggatgtacacgtttggttttgtgaattgtgattatt |
49877 |
T |
 |
| Q |
107 |
ccaaacaatactctaatttaatttactttggattttaatatgattgaataaaactataagactaagacatgaaagttgtcacgtttaattaaatttcata |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
49876 |
ccaaacaatactctaatttaatttactatggattttaatatgattgaataaaactataagactaagacatgagagttgtcacgtttaattaaattccata |
49777 |
T |
 |
| Q |
207 |
ggtataaaaatgttgtaataatgtttatgaatgaattatgtg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49776 |
ggtataaaaatgttgtaataatgtttatgaatgaattatgtg |
49735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University