View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_20 (Length: 254)
Name: NF5081_low_20
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 40393303 - 40393067
Alignment:
| Q |
1 |
tacagggctagcataacttgtaatagtgttgtgggctactacattggtttgactacaaacaaacnnnnnnnnngagagggactacaaacaaacttgacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40393303 |
tacagggctagcataacttgtaatagtgttgtgggctcctacattggtttgactacaaacaaactttttttt--agagggactacaaacaaacttgacaa |
40393206 |
T |
|
| Q |
101 |
catcattaacttaaccatgtctttttctgtnnnnnnnnnnnnnn-gatcaaccatgcatttgattttatcttgaattgaaaaaatacaatatacttttgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40393205 |
catcattaacttaaccatgtctttttctgtaaaaaaaaaaaaaaagatcaactatgcatttgattttatcttgaattgaaaaaatacaatatacttttgt |
40393106 |
T |
|
| Q |
200 |
catctaggaaactttaatctatttcaaattcacatcttg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40393105 |
catctaggaaactttaatctatttcaaattcacatcttg |
40393067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University