View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_22 (Length: 252)
Name: NF5081_low_22
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37655217 - 37655025
Alignment:
| Q |
1 |
tgatatggtatgtataagaccgatcaaagtttcatattttctttttataacaagaagagagttaaatactaacatggatcattnnnnnnntcatatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| | |
|
|
| T |
37655217 |
tgatatggtatgtataagaccggtcaaagtttcatattttctttttataacaagaagagagttaaatactaacatcgatcattaaaaaaatcatatttat |
37655118 |
T |
 |
| Q |
101 |
taacaagaaggaaaacaatataatcggnnnnnnnnaacattttcaccatgattggcaaaacaaaattaggtacataataggggtgtattagag |
193 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
37655117 |
tagcaagaaggaaaacaatataatcgattttttttaacattttcaccatgattggcaaaacaaaattaggtacatactaaggatgtattagag |
37655025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 193 - 239
Target Start/End: Complemental strand, 51165516 - 51165470
Alignment:
| Q |
193 |
ggagtgcagatctgctcaatttctatatctgtccagttacccggttc |
239 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
51165516 |
ggagtgcagatctgctccatttttatatctgtccagttacccggttc |
51165470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 194 - 239
Target Start/End: Original strand, 51164866 - 51164911
Alignment:
| Q |
194 |
gagtgcagatctgctcaatttctatatctgtccagttacccggttc |
239 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
51164866 |
gagtgcagatctgctccatttctatatatgtccagttacccggttc |
51164911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University