View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_24 (Length: 251)
Name: NF5081_low_24
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 8 - 242
Target Start/End: Original strand, 9235187 - 9235420
Alignment:
| Q |
8 |
ccattctttcttgtctttagtttttccaaaatataaacaaagacaagcccttttgtttcttacatatatattgtcttgtcatataaacattgtttctttt |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
9235187 |
ccattctttcttgtctttagttcttccaaactataaacaaagacaagcccttttgtttcttacatatatattgtcttgtcacat--acattgtttctttt |
9235284 |
T |
|
| Q |
108 |
cttgtttcacaaaattacaacccaattgtatgttgtggtagatatgtatacatagtcttgcttcgga-nnnnnnngcattctttctgctctttagggttt |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| ||| |||||| |
|
|
| T |
9235285 |
aatgttacacaaaattacaacccaattgtatgttgtggtagatatgtatacatagtcatgcttcggattttttttgcattctttgtgcccttgtgggttt |
9235384 |
T |
|
| Q |
207 |
ccttgtagagcactttgtgtcatttttcagtattat |
242 |
Q |
| |
|
||||||| |||| ||||||| ||||||| ||||||| |
|
|
| T |
9235385 |
ccttgtaaagcattttgtgtaatttttcggtattat |
9235420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University