View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_28 (Length: 241)
Name: NF5081_low_28
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 241
Target Start/End: Original strand, 41862685 - 41862906
Alignment:
| Q |
20 |
gtgctcacagaatcattatggttggaactcatatggctcattgattggtgggcgggcgtcaaggtcttaatttgattgattaccttaatctatattaata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41862685 |
gtgctcacagaatcattatggttggaactcatatggctcattgattggtgggcgggcgtcaaggtcttaatttgattcattaccttaatctatattaata |
41862784 |
T |
 |
| Q |
120 |
tgttgtttatctatgttctaaaccctctttcttgcctattaatttgtcgagtattcgggttgcaggtcgagctgtacgcagattcagaaacatttcaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41862785 |
tgttgtttatctatgttctaaaccctctttcttgcctattaatttgtcgagtatttgggttgcaggtcgagctgtacgcagattcagaaacatttcaatt |
41862884 |
T |
 |
| Q |
220 |
aatgggtaagttaacatggttt |
241 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
41862885 |
aatgggttagttaacatggttt |
41862906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University