View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5081_low_30 (Length: 225)
Name: NF5081_low_30
Description: NF5081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5081_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 11616337 - 11616122
Alignment:
| Q |
1 |
ccttgccgcatattttgccacgttcttgatttcatgaaaatctcccatccattttcttatatcacccgtggttagtccagttctcggtgcaaacatccac |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11616337 |
ccttgccgcgtattttgccacgttcttgatttcatgaaaatctcccatccattttcttatatcacccgtagttagtccagttctcggtgcaaacatccac |
11616238 |
T |
|
| Q |
101 |
gctgagttatcgcgcaattggcttgacgagaaagcaagaaactcgaacttcttgtcaccgatttttatgccgttttttagtgtagacagtaccctttgat |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
11616237 |
gctgagttatcgcgcaattgacttgacgagaaagcaagaaactcgaacttcttgtcaccgatttctatgccgttcgttagtgtagacagtaccctttgat |
11616138 |
T |
|
| Q |
201 |
gaacctttgcttctcc |
216 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
11616137 |
gaacctttgattctcc |
11616122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University