View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082-Insertion-10 (Length: 45)
Name: NF5082-Insertion-10
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082-Insertion-10 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 38139129 - 38139092
Alignment:
| Q |
8 |
taaacttgttgcttgggagtcatggctcctatggattc |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38139129 |
taaacttgttgcttgggagtcatggctcctatggattc |
38139092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 39315310 - 39315345
Alignment:
| Q |
8 |
taaacttgttgcttgggagtcatggctcctatggat |
43 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| |
|
|
| T |
39315310 |
taaacttgttgcttgggagtcaagactcctatggat |
39315345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University