View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082-Insertion-11 (Length: 64)
Name: NF5082-Insertion-11
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 26597609 - 26597552
Alignment:
| Q |
7 |
aatcctcacaatcatttcctcctcaacaacatgagcaggttcaatgtttttccttcca |
64 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26597609 |
aatcctcacaatcgtttcctccttaacaacatgagcaggttcaatgtttttccttcca |
26597552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University