View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082-Insertion-13 (Length: 469)
Name: NF5082-Insertion-13
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 7 - 469
Target Start/End: Complemental strand, 25303330 - 25302866
Alignment:
| Q |
7 |
aataccaacacaacaaactatcataattgactaccacccttcacatgaataaccaaccccacaaactcatcaaaatcctcaaccaaccgttcatcccctc |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25303330 |
aataccaacacaacacactatcataattgactaccacccttcacatgaataaccaaccccacaaactcatcaaaatcctcaaccaaccgttcatcccctc |
25303231 |
T |
 |
| Q |
107 |
taccactcnnnnnnnnnnncttttcatcataacttttcatgaaatttaagatatatagcacgtgcagacaaatttcaccgaaaaccactctcaaataagc |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25303230 |
taccactctttttttttt-cttttcatcataacttttcatgaaatttaaaatatatagcacgtgcagacaaatttcaccgaaaaccactctcaaataagc |
25303132 |
T |
 |
| Q |
207 |
accattatttttactctttatatattatcctctgtttttcttaactcaacaccgcttatactctgtttttatccaaataaccctgttttctccattatcc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
25303131 |
accattatttttactctttatatattatcctctgtttttcttaactcaacaccgcttatactctgtttttatccaaatgaccctgttttctccgttatcc |
25303032 |
T |
 |
| Q |
307 |
ttttttccctttcaccacaccaccattaccaatgcttcccttttaagaaaatcaacattttctcacacccttttgaccctttttcacaatatatttatta |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25303031 |
ttttttccctttcaccacaccaccattaccaatgcttcccttttaagaaaaccaacattttctcacacccttttgaccctttttcacaatatatttatta |
25302932 |
T |
 |
| Q |
407 |
aatcacgtgtttcaaacaccaccaaaatacac---catctttttcttcattttcttcctctgtatc |
469 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25302931 |
aatcacgtgtttcaaacaccaccaaaatacaccatcatctttttcttcattttcttcctctgtatc |
25302866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University