View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_15 (Length: 427)
Name: NF5082_high_15
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 11 - 409
Target Start/End: Complemental strand, 34231022 - 34230622
Alignment:
| Q |
11 |
cagagacagcttgaagattgtccaacnnnnnnnnnnnncactggttttctacatatctcgggtggggactagatatctcttgtagaatatgttcttttag |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34231022 |
cagagacagcttgaagattgtccaactttttattttttcactggttttctacatatctcgggtggggactagatatctcttgtagaatatgttcttttag |
34230923 |
T |
 |
| Q |
111 |
cagctcttatagtttttaagtcaatggggt--gatcctttaaccttataaaacttgaaaggttatgatgcttaaagaagaattttgtagtgttattcagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34230922 |
cagctcttatagtttttaagtcaatgggtgcagatcctttagccttataaaacttgaaaggttatgatgcttaaagaagaattttgtagtgttattcagg |
34230823 |
T |
 |
| Q |
209 |
aagactcttgctaggaatcacatccttttagagatatctatctatttgtggagtacttctatttgaggaactatttgttactttttgtatgtaggtacat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34230822 |
aagactcttgctaggaatcacatccttttagagatatctatctatttgtggagtacttctatttgaggaactatttgttactttttgtatgtaggtagat |
34230723 |
T |
 |
| Q |
309 |
tgatacacatcataaatatcaatagcacataatataccagagagctatttgtcatattttagaatttgtattctaaattgagttgctttttagggtgaag |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34230722 |
tgatacacatcataaatatcaatagcacataatataccagagagctatttgtcatattttagaatttgtattctaaattgagttgctttttagggtgaag |
34230623 |
T |
 |
| Q |
409 |
g |
409 |
Q |
| |
|
| |
|
|
| T |
34230622 |
g |
34230622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University