View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_19 (Length: 355)
Name: NF5082_high_19
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 49697004 - 49696670
Alignment:
| Q |
1 |
catcactaccgagttcaagttctttaggaggggggagaaattgttgcggtgtcggggggtgtaaaagagtgggggttatggatagagaggggttcggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| || |||||||||||||| | |||||||||||||| || | ||| |
|
|
| T |
49697004 |
catcactaccgagttcaagttcttgaggaggggagagaaattgttgcggtgtcggtggttgtaaaagagtgggagaaatggatagagagggttttgttag |
49696905 |
T |
|
| Q |
101 |
ggttttgagaattttaggtcgcagatagtttttcctttgaccagttttcgaagagacgataatgtttcgtctcgtggtgaatggcgcatggaaggagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49696904 |
ggttttgagaattttaggtcgcagatagtttttcctttgaccagttttcgaagagacgataatgtttcgtctcgtggtgaatggcgcatggaaggagaag |
49696805 |
T |
|
| Q |
201 |
aagcaatgcgcaatcgccattgatgctgcaaagacgagaagaagcaggcagattctgttcaattttacttacggagcttcctaggattttttataactgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49696804 |
aagcaatgcgcaatcgccattgatgctgcaaagacgagaagaagcaggcagattctgttcaa-tttacttacggagcttcctaggattttttataactgc |
49696706 |
T |
|
| Q |
301 |
accccacattttccattttgcccacgtaatgttttt |
336 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
49696705 |
accccacattttccattttgcccacctaattttttt |
49696670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University