View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_29 (Length: 312)
Name: NF5082_high_29
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 11173200 - 11172894
Alignment:
| Q |
1 |
cgagaacaataccttcagtgaaagcctttgtgctatgctgaagttaattggaatcttcatatttgaattgtatgtgtcatatagaaaactttgtttctca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173200 |
cgagaacaataccttcagtgaa-gcctttgtgctatgctgaagttaattggaatcttcatatttgaattgtatgtgtcatatagaaaactttgtttctca |
11173102 |
T |
|
| Q |
101 |
tcattggtgaatatggactcataagttaataagttattcggttgagtcggatttttcagttaaatttgtttattggagggtataatgttgttttccatat |
200 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
11173101 |
tcattggtgaatatggattcatatgctaataagttattcggttgagtcggatttttcagttaaatttgtttattggggggtataa---tgttttccatat |
11173005 |
T |
|
| Q |
201 |
tata-----------------tatttcacctgggattattatatattatggtcattgttgctataaatcaatttatcatttgctaattttgtgtgtgata |
283 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
11173004 |
tatatatatatgtacttgaattatttcacctgggattattatatattatggtcattgttgctaaatatcaatttatcatttggtaattttgtgtgtgata |
11172905 |
T |
|
| Q |
284 |
ttgtttagagt |
294 |
Q |
| |
|
||||||||||| |
|
|
| T |
11172904 |
ttgtttagagt |
11172894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University