View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_46 (Length: 247)
Name: NF5082_high_46
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 5414950 - 5414728
Alignment:
| Q |
10 |
gcacagagtctttgatgcctgattcttcacaattttgtgaggcatcactatttacatctaaaactacctcatgatgaatttcgttgctttctgaattatc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414950 |
gcacagagtctttgatgcctgattcttcacaattttgtgaggcatgactatttacatctaaaactacctcatgatgaatttcgttgctttctgaattatc |
5414851 |
T |
 |
| Q |
110 |
agtcatggttgacaaaaataaatatatactacatatattttttatatgaagctgaaaaatggcgcaagaaatgaatgtggctctgctattgacaaacaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414850 |
agtcatggttgacaaaaataaatatatactacatatattttttatatgaagctgaaaaatggcgcaagaaatgaatgtggctctgctattgacaaacaat |
5414751 |
T |
 |
| Q |
210 |
tgatgagaaaaactatttgagaa |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5414750 |
tgatgagaaaaactatttgagaa |
5414728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 5388223 - 5388167
Alignment:
| Q |
10 |
gcacagagtctttgatgcctgattcttcacaattttgtgaggcatcactatttacat |
66 |
Q |
| |
|
||||| |||||| ||||| ||| || ||||||||||| |||||||||| |||||||| |
|
|
| T |
5388223 |
gcacatagtcttggatgcatgactcatcacaattttgggaggcatcaccatttacat |
5388167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University