View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_49 (Length: 245)
Name: NF5082_high_49
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 25785696 - 25785488
Alignment:
| Q |
10 |
cgaatatggacccctcgacaaattacgagtggataatattggaaaaaacaagaagcttttcacatttcaatgcgctcaaataaccaacacattttatgtt |
109 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25785696 |
cgaatatggaccccttgacaaattatgagtggataatattggaaaaaacaagaagcttttcacatttcgatgcgctcaaataaccaacacattttatgtt |
25785597 |
T |
 |
| Q |
110 |
cttaactaaaactgaaacacatatagcataatttggtgaatcatattaaaatttccaacgttattaatgaccaatacaaaaacaaaa-agataaaa--ga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
25785596 |
cttaactaaaactgaaacacatatagcataatttggtgaatcatattaaaatttccaacgttattaatgaccaatacaaaaacaaaagagataaaaagga |
25785497 |
T |
 |
| Q |
207 |
gattattca |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
25785496 |
gattattca |
25785488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University