View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_58 (Length: 236)
Name: NF5082_high_58
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 48982854 - 48982640
Alignment:
| Q |
1 |
ttctatttttaactatcttaatcatttcaatacnnnnnnnattcattacaacaataaccgagtannnnnnnnnngaaaaagaaataataaccaagtatta |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||| ||||||| |
|
|
| T |
48982854 |
ttctatttttaactttcttaatcatttcaatactttttttattcattacaacaataaccgagtattttttttt-gagaaagaaataataacccagtatta |
48982756 |
T |
|
| Q |
101 |
tcaccataagtatggacgactgactacatagatcaaacaaatcaatttactacgttgtgtgttacatcattatccaaatcattaacatctagagtattca |
200 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48982755 |
ttaccataagtatggacgact----acatagatcaaacaaatcaatttattacgttctgtgttacatcattatccaaatcattaacatctagagtattca |
48982660 |
T |
|
| Q |
201 |
ttagtaatagaagtcatttc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48982659 |
ttagtaatagaagtcatttc |
48982640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University