View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_59 (Length: 228)
Name: NF5082_high_59
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_59 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 35426056 - 35426277
Alignment:
| Q |
7 |
ccttttgtgttaccattttaaccttttgtatatatagatgattttgaaaggaaaaatattgaggactagcatgacaacaccttaatcattgagaaattaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35426056 |
ccttttgtgttaccattttaaccttttgtatagatagatgaatttgaaaggaaaagtattgaggactagcatgacaacacgttaatcattgagaaattaa |
35426155 |
T |
|
| Q |
107 |
attggaacgaccaaaaaatttctctaggaggtgaatcgaaggatnnnnnnnntaagtttctttttccatactccacatttctaaaaacagcacatcatct |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35426156 |
attggaacgaccgaaaaatttctctaggaggtgaatcgaaggataaaaaaaataagtttctttttccatactccatatttctaaaaacagcacatcatct |
35426255 |
T |
|
| Q |
207 |
agtatgcagaactgaaaatttt |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35426256 |
agtatgcagaactgaaaatttt |
35426277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University