View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_high_61 (Length: 222)
Name: NF5082_high_61
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_high_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 16470814 - 16470735
Alignment:
| Q |
1 |
tggggcgtgtggggtttgagagaagagtctatgtgttcttttgacaacttagtttatccttcaattttggaatttctaag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16470814 |
tggggcgtgtggggtttgagagaagagtctatgtgttcttttgacaacttagtttatccttcaattttggaatttctaag |
16470735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 16470669 - 16470613
Alignment:
| Q |
146 |
atttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16470669 |
atttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccaga |
16470613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University