View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_low_35 (Length: 277)
Name: NF5082_low_35
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 6 - 156
Target Start/End: Original strand, 224636 - 224786
Alignment:
| Q |
6 |
acttttggcacatgccaacatatcataataatctacatggttgaagcaatcacggaaatctgtaaaaagcttctcaaacaccctccattgaactttgact |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224636 |
acttttggcacatgccaacatatcataataatctacatggttgaagcaatcacggaaatctgtaaaaagcttctcaaacaccctccattgaactttgact |
224735 |
T |
 |
| Q |
106 |
gatctagtgtaaggatatggaagaaaaacctgctgaaagttattgcaaaaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224736 |
gatctagtgtaaggatatggaagaaaaacctgctgaaagttattgcaaaaa |
224786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 224820 - 224936
Alignment:
| Q |
151 |
caaaaatctcatccttttgcacaaatctatgaaataatgataaagaatatataggtataaaattgtaagtgtcttaagaagcaagcaaaatactaactaa |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224820 |
caaagatctcatccttttgcacaaatctatgaaataatgataaagaatatataggtataaaattgtaagtgtcttaagaagcaagcaaaatactaactaa |
224919 |
T |
 |
| Q |
251 |
acttacatccccttcat |
267 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
224920 |
acttacatccccttcat |
224936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University