View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_low_45 (Length: 248)
Name: NF5082_low_45
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 25785740 - 25785979
Alignment:
| Q |
2 |
ttaacttgaaagaaattctctaattgatttagattggactgtcctccagtcaaagattgataactgcttgcaacagttactataggaaattgtagtccat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25785740 |
ttaacttgaaagaaattctctaattgatttagattggacggtcctccagtcaaagattgataactgcttgcaacagttactataggaaattgtagtccat |
25785839 |
T |
 |
| Q |
102 |
ttgctgagtatagagttcaattgttgacattttggattagaaattgagttaatattttgattgatgcatgcattttctaaacacattgataagattattc |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25785840 |
ttgccgagtatagagttcaattgttgacattttggattagaaattgagttaatattttgattgatgcatgcattttctaaacacattgataagattattc |
25785939 |
T |
 |
| Q |
202 |
ttgtcttaaggtttcaggataggat--tattttggatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25785940 |
ttgtcttaaggtttcaggataggattatattttggatatt |
25785979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University