View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5082_low_50 (Length: 245)

Name: NF5082_low_50
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5082_low_50
NF5082_low_50
[»] chr7 (1 HSPs)
chr7 (10-215)||(25785488-25785696)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 25785696 - 25785488
Alignment:
10 cgaatatggacccctcgacaaattacgagtggataatattggaaaaaacaagaagcttttcacatttcaatgcgctcaaataaccaacacattttatgtt 109  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
25785696 cgaatatggaccccttgacaaattatgagtggataatattggaaaaaacaagaagcttttcacatttcgatgcgctcaaataaccaacacattttatgtt 25785597  T
110 cttaactaaaactgaaacacatatagcataatttggtgaatcatattaaaatttccaacgttattaatgaccaatacaaaaacaaaa-agataaaa--ga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||  ||    
25785596 cttaactaaaactgaaacacatatagcataatttggtgaatcatattaaaatttccaacgttattaatgaccaatacaaaaacaaaagagataaaaagga 25785497  T
207 gattattca 215  Q
    |||||||||    
25785496 gattattca 25785488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University