View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_low_51 (Length: 245)
Name: NF5082_low_51
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 43416283 - 43416096
Alignment:
| Q |
40 |
tataacactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416283 |
tatagcactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca |
43416184 |
T |
|
| Q |
140 |
atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416183 |
atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatac |
43416096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 43416346 - 43416303
Alignment:
| Q |
1 |
ttagaagaatacatcaatttttgttgactcatattctcttataa |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416346 |
ttagaagaatacatcaatttttgttgactcatattctcttataa |
43416303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University