View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5082_low_53 (Length: 240)
Name: NF5082_low_53
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5082_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 99 - 203
Target Start/End: Original strand, 50176492 - 50176596
Alignment:
| Q |
99 |
acatatcaggtagttaatgactttaaagtttgcatatgaatacttttcatttcgtattaaaattttagtaacttaacttaatttcaagtaaagtttgatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50176492 |
acatatcaggtagttaatgactttaaagtttgcatatgaatacttttcatttcgtattaaaattttagcaacttaacttaatttcaagtaaagtttgatc |
50176591 |
T |
 |
| Q |
199 |
cttat |
203 |
Q |
| |
|
||||| |
|
|
| T |
50176592 |
cttat |
50176596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 113
Target Start/End: Original strand, 50176418 - 50176470
Alignment:
| Q |
63 |
ataagtagaaataaatcatattacaaattaa--ccgatacatatcaggtagtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50176418 |
ataagtagaaataaatcatattacaaattaactctgatacatatcaggtagtt |
50176470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University