View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5082_low_53 (Length: 240)

Name: NF5082_low_53
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5082_low_53
NF5082_low_53
[»] chr3 (2 HSPs)
chr3 (99-203)||(50176492-50176596)
chr3 (63-113)||(50176418-50176470)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 99 - 203
Target Start/End: Original strand, 50176492 - 50176596
Alignment:
99 acatatcaggtagttaatgactttaaagtttgcatatgaatacttttcatttcgtattaaaattttagtaacttaacttaatttcaagtaaagtttgatc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
50176492 acatatcaggtagttaatgactttaaagtttgcatatgaatacttttcatttcgtattaaaattttagcaacttaacttaatttcaagtaaagtttgatc 50176591  T
199 cttat 203  Q
    |||||    
50176592 cttat 50176596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 113
Target Start/End: Original strand, 50176418 - 50176470
Alignment:
63 ataagtagaaataaatcatattacaaattaa--ccgatacatatcaggtagtt 113  Q
    |||||||||||||||||||||||||||||||  | ||||||||||||||||||    
50176418 ataagtagaaataaatcatattacaaattaactctgatacatatcaggtagtt 50176470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University