View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5082_low_62 (Length: 222)

Name: NF5082_low_62
Description: NF5082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5082_low_62
NF5082_low_62
[»] chr2 (2 HSPs)
chr2 (1-80)||(16470735-16470814)
chr2 (146-202)||(16470613-16470669)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 16470814 - 16470735
Alignment:
1 tggggcgtgtggggtttgagagaagagtctatgtgttcttttgacaacttagtttatccttcaattttggaatttctaag 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16470814 tggggcgtgtggggtttgagagaagagtctatgtgttcttttgacaacttagtttatccttcaattttggaatttctaag 16470735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 16470669 - 16470613
Alignment:
146 atttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccaga 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16470669 atttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccaga 16470613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University