View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5083-Insertion-11 (Length: 217)
Name: NF5083-Insertion-11
Description: NF5083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5083-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 37928304 - 37928514
Alignment:
| Q |
8 |
aagtcaagtttcgtgggttaaccattaaaggcgcacacactttaattttggatacttgttgaattgctgaagtattggatatggcacttgtaggctgtct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37928304 |
aagtcaagtttcgtgggttaaccattaaaggcgcacacactttaattttggatacttgttgaattggtgaagtattggatatggcacttgtaggctgtct |
37928403 |
T |
|
| Q |
108 |
ctgtattgttcctcctgcaagtgtgccatttattgtttttgttattccttgattgcaagattgaaggnnnnnnnac-tttgagttcggtttgcacgattc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
37928404 |
ctgtattgttcctcctgcaagtgtgccatttattgtttttgttattccttgattgcaagattgaaggtttttttacttttgagttcggtttgcacgattc |
37928503 |
T |
|
| Q |
207 |
tttggtttcgg |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
37928504 |
tttggtttcgg |
37928514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University