View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5083-Insertion-6 (Length: 374)
Name: NF5083-Insertion-6
Description: NF5083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5083-Insertion-6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 167 - 374
Target Start/End: Complemental strand, 44353812 - 44353599
Alignment:
| Q |
167 |
caggaaggaagagaaaagattagtgagagaataaaaatgctcaaagatttagtccctggatataacaagttggcaaacataataatttcttctaacttat |
266 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||| |||||||||||| |||||||| |||||| |
|
|
| T |
44353812 |
caggaaagaagagaaaagattagtgagagaataaaaatgctcgaagatttagtccctcgatataccaagttagcaaacataatagtttcttctgacttat |
44353713 |
T |
|
| Q |
267 |
attctatcatttgcattgaattgttattgtttctatg------nnnnnnnnattgtttaggtaattggtaaagcactcatgctatatgagataatcaatt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44353712 |
attctatcatttgcattgaattgttattgtttctatgttttttttttttttattgtttaggtaattggtaaaacactcatgctatatgagataatcaatt |
44353613 |
T |
|
| Q |
361 |
atattcaatcactg |
374 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44353612 |
atattcaatcactg |
44353599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 44355572 - 44355497
Alignment:
| Q |
7 |
agctaaataaataaatcctaacaaactttatctatcttaatataattcactgatagtcgtagtctcattaaaagag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
44355572 |
agctaaataaataaatcctaacaaactttatctatcttaatataatccactgatagtcgtagtctcattgaaagag |
44355497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University