View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5083_low_2 (Length: 450)
Name: NF5083_low_2
Description: NF5083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5083_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 4e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 287 - 435
Target Start/End: Original strand, 43301284 - 43301432
Alignment:
| Q |
287 |
tgtggaacagtgcatggaacatgggtgtgtggtagaaagcttgaacatggtgtgagcgttgatttgaaggaaggtgatagctttcagcttgggagttcaa |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43301284 |
tgtggaacagtgcatggaacatgggtgtgtggtagaaagcttgaacatggtgtgagcgttgatttgaaggaaggtgatacctttcagcttgggagttcaa |
43301383 |
T |
 |
| Q |
387 |
gtagggtttatcttcttcaatttgtatctcaattcgatgatgtggatgc |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43301384 |
gtagggtttatcttcttcaatttgtatctcaattcgatgatgtggatgc |
43301432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 43301006 - 43301156
Alignment:
| Q |
10 |
acatcatcatcctcaacaataacaacaataataacaaatacaacgatgatcaaatcctcctcgttggtcgacacccaaattgtaacattgtactctttca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43301006 |
acatcatcatcctcaacaataacaacaacaataacaaatacaacgatgatcaaatcctcctcgttggtcgacacccaaattgtaacattgtcctctttca |
43301105 |
T |
 |
| Q |
110 |
ccctagcatcagccgtttccatcttcagattcgattcaatccttcttcccg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43301106 |
ccctagcatcagccgtttccatcttcagattcgattcaatccttcttcccg |
43301156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University