View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5083_low_6 (Length: 292)
Name: NF5083_low_6
Description: NF5083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5083_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 274
Target Start/End: Complemental strand, 44355815 - 44355567
Alignment:
| Q |
26 |
ctatccctaaaacagtttacaaatcaaacacagcataactagacttgtcatatcatatccttcatattttaacatatcaaaaacacccaataattcactc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
44355815 |
ctatccctaaaacagtttacaaatcaaacaccacacaactagatttgtcatatcatatccttcattttttaacatatcaaacacacccagtaattcactc |
44355716 |
T |
 |
| Q |
126 |
ttaccttagtacacaatactatgtcatatccctaattatgagaccacccactccaagcccgaatgagtcacaaaccaacctcatacaatgtgtctttatc |
225 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44355715 |
ttacctcagtacacaatactctgtcatatccctaattatgagaccacccactccaagcccgaatgggtcacaaaccaacctcatacaatgtgtctttatc |
44355616 |
T |
 |
| Q |
226 |
tatctcactttcacctcatccatcaaacacatagcagttgggtagctaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44355615 |
tatctcactttcacctcatccatcaaactcatagcagttgggtagctaa |
44355567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 3414880 - 3414815
Alignment:
| Q |
41 |
tttacaaatcaaacacagcataactagacttgtcatatcatatccttcatattttaacatatcaaa |
106 |
Q |
| |
|
|||||||||||||||| | |||| |||| |||| | |||||||||||||||||||||| |||||| |
|
|
| T |
3414880 |
tttacaaatcaaacactggataattagagttgttttgtcatatccttcatattttaacaaatcaaa |
3414815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University