View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5083_low_8 (Length: 277)
Name: NF5083_low_8
Description: NF5083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5083_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 15 - 265
Target Start/End: Original strand, 5994299 - 5994548
Alignment:
| Q |
15 |
actaatatccgagttttcttcaaccttcaaatcctccaccggtctcaaagttcaaaatggataatttaatgaaggttgaatcgatcgggagtatctaagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5994299 |
actaatatccgagttttcttcaaccttcaaatcctccaccggtctcaaagttcaaaatggataatttaatgaaggttgaatcgatcgggagtatttaagt |
5994398 |
T |
|
| Q |
115 |
ttagactctgactggaacaatccttagctagaatttacttacttttgaccaaattcatgattaacatggtccctttgccatgggaaccggagggttaaga |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
5994399 |
ttagactctgactagaacaatccttagctagaatttacttacttttgaccaaattcatgattaacagggtccctttcccatgggaaccggagggttaaga |
5994498 |
T |
|
| Q |
215 |
caaaagattatgggaaaacactgtcttttacaagtagaaaaagatctagaa |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5994499 |
caaaagattatgggaaaacactgtcttttacaagt-gaaaaagatctagaa |
5994548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University