View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5084-Insertion-10 (Length: 319)
Name: NF5084-Insertion-10
Description: NF5084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5084-Insertion-10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 319
Target Start/End: Complemental strand, 3527288 - 3526974
Alignment:
| Q |
8 |
atatacttatgtggtatcaacttcaataccagctcctgcataggtatgtgaaatgaaaacatatttaatacttcttccgtcctaaatcgactgacccatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3527288 |
atatacttatgtggtatcaacttcaataccagctcctgcataggtatgtgaaatgaaaacatatttaatacttcttccgtcctaaatcgactgacccatt |
3527189 |
T |
|
| Q |
108 |
gaagaagnnnnnnnntttgatttttagagga-tattacttttttattttccaattctaccatataa----gtacactactttcatcaattcaatttataa |
202 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3527188 |
gaagaaaaaaaaaa--ttgatttttagaggaatattacttttttattttccaattctaccatataattaagtacactactttcatcaattcaatttataa |
3527091 |
T |
|
| Q |
203 |
taataatgagattacatcaatccatgcatttatatcctgatatttcgtaattggaaattttcagcttcttctccaactcttcccctgtcgtcattgcagc |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3527090 |
taataatgagattacatcaatacatgcatttatatcctgatatttccttattggaaattttcagcttcttctccaactcttcccctgtcgtcattgcagc |
3526991 |
T |
|
| Q |
303 |
ccccaggtaaaatcctc |
319 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3526990 |
ccccaggtaaaatcctc |
3526974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University