View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5084_low_11 (Length: 256)
Name: NF5084_low_11
Description: NF5084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5084_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 37 - 200
Target Start/End: Original strand, 50438757 - 50438920
Alignment:
| Q |
37 |
caagtatctttgaggctcgatgtgtaatttagtgcaaagttttctttccgtaaatctagaacacgaaattagcatatggtgtacaaattagtgcatgtaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50438757 |
caagtatctttgaggctcgatgtgtaatttagtgcaaagttttctttccgtaaatctagaacacgaaattagcatatggtgtacaaattagtgcatgtaa |
50438856 |
T |
|
| Q |
137 |
ctttattcgttaaatcaagcactcatattccttctctcnnnnnnnaataatattaagagggata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50438857 |
ctttattcgttaaatcaagcactcatattccttctctatttttttaataatattaagagggata |
50438920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 190 - 237
Target Start/End: Original strand, 50438940 - 50438987
Alignment:
| Q |
190 |
taagagggataagttgatcaactaaaccggtggtgggaacacccttac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50438940 |
taagagggataagttgatcaactaaaccggtggtgggaacacccttac |
50438987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University