View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5084_low_12 (Length: 255)
Name: NF5084_low_12
Description: NF5084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5084_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 50 - 237
Target Start/End: Complemental strand, 27873989 - 27873802
Alignment:
| Q |
50 |
tactattaaaaaagattgatgttatgtttgaaaatgcagtcgaatgaagctagaaaagcctaaaaaagtatacaattacggtgaattgacgcggattcaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
27873989 |
tactattaaaaaagattgatgttatgtttgaaaatgcagtcgaatgaagctagaaaagcctaaaaaagtatacaattacggtcaattgacgtggattcaa |
27873890 |
T |
 |
| Q |
150 |
acactataaaatgaaacgaagggtttcaaaaatgataaacaactagcatttacacttttgaatctccacaaatatctagtcggttcac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873889 |
acactataaaatgaaacgaagggtttcaaaaatgataaacaactagcatttacacttttgaatctccacaaatatctagtcggttcac |
27873802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 27879301 - 27879263
Alignment:
| Q |
17 |
aatataaactgaaatggagtcaatctatacgtctactat |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27879301 |
aatataaactgaaattgagtcaatctatacgtctactat |
27879263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University