View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5084_low_13 (Length: 235)
Name: NF5084_low_13
Description: NF5084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5084_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 6088626 - 6088828
Alignment:
| Q |
17 |
ttgagtggtaattaaaatgtaccatcactactggttaatcttaattacctcttgagagcatcttcattggtttctccatttgtcagtggctcaaagtggc |
116 |
Q |
| |
|
||||||||||||||||||||||| || ||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6088626 |
ttgagtggtaattaaaatgtaccgtctctactaatttatcttaattacctcttgagagcttcttcattggtttctccatttgtcagtggctcaaagtgac |
6088725 |
T |
|
| Q |
117 |
cattttccaaattgactctagagaccggtttctttaacaagttctcgccaatttggcacagtttcttcaagttctcctctgtagcaatgtcaactgaaga |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| || || || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088726 |
cattttctaaattgactctagagaccggtttctttaataaattttcaccaatttggcacagtttcttcaagttctcctctgtagcaatgtcaactgaaga |
6088825 |
T |
|
| Q |
217 |
atc |
219 |
Q |
| |
|
||| |
|
|
| T |
6088826 |
atc |
6088828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University