View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5084_low_8 (Length: 314)
Name: NF5084_low_8
Description: NF5084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5084_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 118 - 299
Target Start/End: Original strand, 55301406 - 55301587
Alignment:
| Q |
118 |
caagatcacaactgcatgcccaacataggtaatataatttcttttgtaattgctgcgtatataggttaaaggtgggtgtggctgtaatcattttatattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301406 |
caagatcacaactgcatgcccaacataggtaatataatttcttttgtaattgctgcgtatataggttaaaggtgggtgtggctgtaatcattttatattt |
55301505 |
T |
 |
| Q |
218 |
gaaggacccccaaatgtaggaaagagatccatgatacgggctatgcttcgggaggtatttggcgctgacggagtgcaggtat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301506 |
gaaggacccccaaatgtaggaaagagatccatgatacgggctatgcttcgggaggtatttggcgctgacggagtgcaggtat |
55301587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 55301299 - 55301351
Alignment:
| Q |
11 |
cagagataaagcacttcagctgaaagcattggtaagaagaatatgatgcttcg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301299 |
cagagataaagcacttcagctgaaagcattggtaagaagaatatgatgcttcg |
55301351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University