View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5085_low_4 (Length: 252)
Name: NF5085_low_4
Description: NF5085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5085_low_4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 125 - 252
Target Start/End: Original strand, 42956093 - 42956220
Alignment:
| Q |
125 |
ctgaaacacaatgaattaagatagtgatagcctaaagtgttcacaacttttgagaattcaactctcgcaggtatctagatttaccggtcaagcaatgcaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956093 |
ctgaaacacaatgaattaagatagtgatagcctaaagtgttcacaacttttgagaattcaactctcgcaggtatctagatttaccggtcaagcaatgcaa |
42956192 |
T |
 |
| Q |
225 |
aaaattggatctaggaaccaccttggtt |
252 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
42956193 |
aaaattggatctgggaaccaccttggtt |
42956220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 12 - 98
Target Start/End: Original strand, 42956009 - 42956095
Alignment:
| Q |
12 |
atgaacaaagatgttatcgcaacagcttttataaaaaacataagcaaaaactaacttggtaaattgtaaacacaattaatgatcctg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42956009 |
atgaacaaagatgttatcgcaacagcttttataaaaaacataggcaaaatctaacttggtaaattgtaaacacaattagtgatcctg |
42956095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University