View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086-Insertion-10 (Length: 112)
Name: NF5086-Insertion-10
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086-Insertion-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 26564262 - 26564366
Alignment:
| Q |
8 |
tcatcatcattttcacaacacagagtacatacatatacatacacgatgatgcgcattgagtgaacgttgcgatcatatctgagattcgatggcgtcatcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26564262 |
tcatcatcattttcacaacacagagtacatacatatacatacacgatgatgcgcattgagtgaacgttgcgatcatatctgagattcgatggcgtcatcc |
26564361 |
T |
|
| Q |
108 |
tccac |
112 |
Q |
| |
|
||||| |
|
|
| T |
26564362 |
tccac |
26564366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University