View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086-Insertion-7 (Length: 163)
Name: NF5086-Insertion-7
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 9e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 9e-53
Query Start/End: Original strand, 8 - 156
Target Start/End: Complemental strand, 6968858 - 6968710
Alignment:
| Q |
8 |
gtgtgaatatgtaatgtcaatggtatttgaatataaac--ttacatatatttagaatagcaatgctgaatagcacgagacgaaagagaaagagaaatgat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6968858 |
gtgtgaatatgtaatgtcaatggtatttgaatataaacacttacatatatttagaatagcaatgctgaatagtacgagacgaaagagaaagagaaatgat |
6968759 |
T |
|
| Q |
106 |
atttgtaactagtttttcacaactcttatctctcataatcacatgtgattt |
156 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||| ||| ||||||||| |
|
|
| T |
6968758 |
atttgtaaccagtttttgacaactc--gtctctcatactcatatgtgattt |
6968710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University