View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086_high_30 (Length: 252)
Name: NF5086_high_30
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 16489623 - 16489392
Alignment:
| Q |
1 |
ctatcaatagtggtgctgcattaagatgtgtagcaatctttaaaacactcttgagagatatataggcagtattagagttatgtcgatgatggtaaagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16489623 |
ctatcaatagtggtgctgcattaagatgtgtagcaatctttaaaacactcttgagagatatataggcagtatcagagttatgtcgatgatggtaaagatg |
16489524 |
T |
|
| Q |
101 |
ctaagtcatttattccagtctagaggacnnnnnnnttagtgccttcaaacctacggtaaaagtggaatacttatnnnnnnntaatgctgtcgcttatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
16489523 |
ctaagtcatttattccagtctagaggacaaaaaaattagtgccttcaaacctacgctaaaagt-gaatacttataaaaaaataatgatgtcgcttatttt |
16489425 |
T |
|
| Q |
201 |
gaacttatcatgaatatgatccgatatattctt |
233 |
Q |
| |
|
| ||||||||||||||| || || ||||||||| |
|
|
| T |
16489424 |
gtacttatcatgaatattattcggtatattctt |
16489392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University