View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086_high_36 (Length: 239)
Name: NF5086_high_36
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 8883903 - 8883683
Alignment:
| Q |
1 |
cgtgtaacctcgttcttttttcaatgcagggaatcagtgtccaatgttttgcacggttatagtgttagaagaacatgcttctgattgtatgatgcaatta |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8883903 |
cgtgtaaccgcgttcttttttcaatgcagggaatcagtgtccaatgttttgcacggttatagtgttagaagaacatgcttctgattgtatgatgcaatta |
8883804 |
T |
 |
| Q |
101 |
aaataatgagttagtaaatgatgcaacaattctgagacaacagcaaaatattcttacaaagttatatgattttggtattttctagttattttttatctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8883803 |
aaataatgagttagtaaatgatgcaacaattctgagacaacagcaaaatattcttacaaatttatatgattttggta-tttctagttattttttatctgt |
8883705 |
T |
 |
| Q |
201 |
aaagagtaataatcatacgtag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8883704 |
aaagagtaataatcatacgtag |
8883683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University