View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086_high_37 (Length: 238)
Name: NF5086_high_37
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 1923880 - 1924053
Alignment:
| Q |
18 |
gaaatatagtttcaatagatttttatgcatgtcggcaagcgtaggtggatattatgagatttttctgtgatgacctcttgagtaggattctcacgttttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1923880 |
gaaatatagtttcaatagatttttatgcatgtcggcaagcgtaggtggatattatgagatttttctgtgatgacctcttga---------tcacgttttt |
1923970 |
T |
|
| Q |
118 |
ggttatgtccttttctatatcatcaagtgtgcagtaaatatgtgtttaggtggttgggtggattcaattttactttaatattt |
200 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1923971 |
ggtgatgtccttttctagatcatcaagtgtgcagtaaatatgtgtttaggtggttgggtggattcaattttactttaatattt |
1924053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 59 - 170
Target Start/End: Original strand, 17499113 - 17499224
Alignment:
| Q |
59 |
taggtggatattatgagatttttctgtgatgacctcttgagtaggattctcacgtttttggttatgtccttttctatatcatcaagtgtgcagtaaatat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
17499113 |
taggtggatattatgagatttttctgtgatgacctcttgagtaggattctcacgtttttggtgatgtccttttctagatcatcaagtgtgcagtaactat |
17499212 |
T |
|
| Q |
159 |
gtgtttaggtgg |
170 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17499213 |
gtgtttaggtgg |
17499224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 59 - 170
Target Start/End: Complemental strand, 17554101 - 17553990
Alignment:
| Q |
59 |
taggtggatattatgagatttttctgtgatgacctcttgagtaggattctcacgtttttggttatgtccttttctatatcatcaagtgtgcagtaaatat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
17554101 |
taggtggatattatgagatttttctgtgatgacctcttgagtaggattctcacgtttttggtgatgtccttttctagatcatcaagtgtgcagtaactat |
17554002 |
T |
|
| Q |
159 |
gtgtttaggtgg |
170 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17554001 |
gtgtttaggtgg |
17553990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 17498966 - 17498998
Alignment:
| Q |
18 |
gaaatatagtttcaatagatttttatgcatgtc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17498966 |
gaaatatagtttcaatagatttttatgcatgtc |
17498998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 17554248 - 17554216
Alignment:
| Q |
18 |
gaaatatagtttcaatagatttttatgcatgtc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17554248 |
gaaatatagtttcaatagatttttatgcatgtc |
17554216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University