View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086_low_37 (Length: 239)
Name: NF5086_low_37
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 23 - 235
Target Start/End: Original strand, 32254075 - 32254287
Alignment:
| Q |
23 |
agtaatgttggattgaaattcaagtcttttgttgagatcattactgggaaatggcaagcggatcttttagttcgtaagtcaaaattctatgatacgtata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32254075 |
agtaatgttggattgaaattcaagtcttttgccgagatcattactgggaaatggcgagcggatcttttagttcgtaagtcaaaattctatgatacgtata |
32254174 |
T |
 |
| Q |
123 |
tagttcacaaatgttataaacattacttaatttcttcatatttttccacagatgttattggagttgtatctgatatgggctactgtcagcttaatgaaga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32254175 |
tagttcacaaatgttataaacattacttaatttcttcatatttttccacagatgttattggagttgtatctgatatgggctactgtcagtttaatgaaga |
32254274 |
T |
 |
| Q |
223 |
aaatgggaaaaag |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32254275 |
aaatgggaaaaag |
32254287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University