View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5086_low_7 (Length: 451)
Name: NF5086_low_7
Description: NF5086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5086_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 18 - 443
Target Start/End: Complemental strand, 43985546 - 43985121
Alignment:
| Q |
18 |
aaaattaataggtgaaaatcaagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcgggaaaaagaatgcagtggttgccattttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
43985546 |
aaaattaataggtgaaaatcaagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcggaaaaaagaatgcagtggttgcgattttt |
43985447 |
T |
 |
| Q |
118 |
ggacttcttttgcttcctaggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaataccttgtgcaacaaggaagagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985446 |
ggacttcttttgcttcctaggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaataccttgtgcaacaaggaagagc |
43985347 |
T |
 |
| Q |
218 |
ttgttactgaaactttggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgccgttgattgctgggct |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43985346 |
ttgttactgaaactctggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgccgttgattactgggct |
43985247 |
T |
 |
| Q |
318 |
gttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgtggatgttgctggtgttcttgct |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43985246 |
gttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgttgatgttgctggtgttcttgct |
43985147 |
T |
 |
| Q |
418 |
aaggatgttacacttatgcctttgct |
443 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43985146 |
aaggatgttacacttatgcctttgct |
43985121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University